morphology of xiphinema

Molecular phylogenetic analysis based on sequences of the 28S D2–D3 expansion region revealed that they are in separate clades (Fig. Lamberti, F., Molinari, S., Moens, M., Brown, D. J. F. (2000): The. (2004). B., Franklin, M. T,. Goodey, J. Nématol., 13: 339 – 348, Barsi, L., DE Luca, F. (2008): Morphological and molecular characterization of two putative Xiphinema americanum-group species, X. parasimile and X. simile (Nematoda: Dorylaimida) from Serbia. Photomicrographs were taken with a Leica video camera (DFC490) fitted on a Leica microscope (DM4000B), and edited using Adobe Photoshop CS5. Russ. Stylet 173 – 193 μm long. Currently, species identification of this genus is mainly based on morphological features and morphometrics. Carlos Gutiérrez-Gutiérrez, Carolina Cantalapiedra-Navarrete, Wilfrida Decraemer, Nicola Vovlas, Tom Prior, Juan E. Palomares Rius, Pablo Castillo, Phylogeny, diversity, and species delimitation in some species of the Xiphinema americanum-group complex (Nematoda: Longidoridae), as inferred from nuclear and mitochondrial DNA sequences and morphology, European Journal of Plant Pathology, … X. parasimile sp. from China shared 100 % identities (633/633=100 %). (2014): Molecular and morphological identification of, Loof, P. A. Rectum length 1/2 of the body diam. 2012), from X. brevicolle by having a shorter stylet (137 – 143 vs 144 – 173 μm) (Lordello & Costa 1961; Lamberti et al. Therefore, accurate identification of Xiphinema species using integrate approach is strongly recommended to create a basis for plant pest management. (2000), The codes of the Chinese Xiphinema americanum s.l. ... morphology of adults and juvenile stages of these species from Romania; 2) to test the multiplex polymerase chain Mediterr., 16: 93 – 99, Brown, D. J. F., Topham, P. B. (1970): A contribution to the taxonomy of the genus. — Zoologica Scripta , 39 , 483–498. yokoyama, Pinus sp. Mediterr., 19: 311 – 326, Larget, B., Simon, D. L. (1999): Markov Chain Monte Carlo algorithms for the Bayesian analysis of phylogenetic trees. The codes of the Chinese Xiphinema americanum s.l. Four studied populations (KP793036 – KP793039) of X. They have a long protrusible odontostyle, with 3 basal flanges at the posterior end of the stylet and a relatively posterior guiding ring when compared to the genus Longidorus. Evans, K., Trudgill, D.L., Webster, J.M. In the present study, analysis of morphology and morphometrics indicated that five studied populations (SZX1306 – SZX1310) were very similar to some members belonging to X. americanum-group. populations and close species using both X. americanum-group polytomous identification keys (Lamberti et al., 2000; Lamberti et al., 2004) were presented in Tables 3, 4. Fund. J. Nematropica, 28: 151 – 163, Golden, A. M. (1990): Preparation and mounting nematodes for microscopic observation. ... Xiphinema azarbaijanense n. sp. Syst. However, the sequenced 18S fragments are only 633 – 796 bp without sufficient divergent sites to examine the phylogenetic relationships among dagger species, no significant clades were generated with strong support, thus the 18S tree is presented. State of California Department of Food and Agriculture, Division of Plant Industry, 324pp. Taylor, C.E., Robertson, W.M., 1970. , 7: 59 – 79. Morphology. Nematol., 23: 134 – 144, Cohn, E. (1969): The occurrence and distribution of species of Xiphinema and Longidorus in Israel. Lordello et Costa,1961 (Nematoda: Longidoridae) in Japan. PhD dissertation. Nine new Xiphinema species are described from southern Africa. (2013): Aphelenchida and Xiphinema spp. Nematol. Nematol., 4: 147 – 154. Two economically important Xiphinema species, X.index and X.americanum, are both commonly found in California and tend to be problematic in vineyards. During a survey of nematode biodiversity in Yangmeikeng and Tianxinshan environmental monitoring sites in Shenzhen, China in 2012 – 2014, ten Xiphinema populations (designated as SZX1301 – SZX1310) were recovered from the rhizosphere collected from five plant species including Blechnoid (Blechnum orientale L.), Awn dichotoma (Gleichenia linearis Clarke. 4). The hyaline tip length also varied considerably more in some females and 4 pairs of caudal pores were observed in a few specimens. Coomans, A. Nematol. The conserved morphology and overlapping morphometrics of some species groups in the genus Xiphinema make quarantine regulations and protection methods more difficult. The 25 μl PCR was performed using TaqMix DNA polymerase (Guangzhou Dongsheng Biotech Ltd., Guangzhou, China) according to the manufacturer’s protocol. In addition to D2–D3 of 28S rDNA, other molecular markers, such as ITS-rRNA and the protein-coding mitochondrial gene, cytochrome oxidasec subunit I (COI) were successfully used for diagnosis and reconstruction of phylogenetic relationships within some species of X. americanum-group (Gutiérrez-Gutiérrez et al. Keywords: Xiphinema americanum, morphology, molecular identification, PCR Mol. Rev. Plant Pathol., 134: 561 – 597, Gutié Rrez-Gutié Rrez, C., Cantalapiedra-Navarrete, C., Remesal, E., Palomares-Rius, J. E., Navas-Corté S, J. Revised Edition, Amherst, MA, USA: University of Massachusetts Agricultural Experiment Station, pp. tail shape. Oliveira, C. G., Fenton, B., Malloch, G., Brown, D. J. F., Neilson, R. (2005): Development of species-specific primers for the ectoparasitic nematode species. Decraemer, W., Robbins, R. T. (2007): The who, what and where of Longidoridae and Trichodoridae. J. DOI: 10.1163/1568541054192199, Ni, H. F., Cheng, Y. H., Chen, R. S., Tsay, T. T., Chen, D. Y. J. Ye, W. (1996): Applying Microsoft Works spread sheet in statistics for morphometric data of nematode identification. is reported from Jiangsu, Zhejiang, Hunan, Guangxi, Shandong, Hebei and Inner Mongolia, Sichuan, Yunnan (CABI, 2011; Wang & Wu, 1992; Xu et al., 1995). Biol. J. Linn. Other documented hosts include: Nectarine, oak, rose, grapevine, raspberry, carrot, cherry, peach, and soybean. Plant Dis., 68: 950 – 952, Nunn, G. B. This group may contain many cryptic species that are morphologically indistinguishable but may be phylogenetically distant to one another (Gutiérrez-Gutiérrez et al. [3], Eggs are laid singly in thin water layers in the soil and are not part of an egg mass. 3th Edition, 214pp. Initial morphometric data and descriptions of males and the four juvenile stages of Xiphinema coxi coxi Tarjan, 1964 collected from soil about the roots of alfalfa (Medicago sativa L.) at Gainesville, Florida, and from a greenhouse microplot at Fayetteville, Arkansas, are given. J. Beijing For. B., Good, J. M., Adams, W. E. (1969): Population dynamics of plant nematodes in cultivated soil: effect of sod-based rotations in cecil sandy loam. Aspects of the morphology and taxonomy of the Nematode genera Xiphinema and Xiphidorus - Hutsebaut, Mieke. nov. is characterised by a very long body (7.2–8.7 mm), a very long odontostyle and odontophore (190–206 and 105–120 µm, respectively), and a well developed pseudo-Z-organ, comprising 8 to 12 sclerotised bodies. Mediterr., 31: 39 – 41, Decraemer, W., Robbins, R. T. (2007): The who, what and where of Longidoridae and Trichodoridae. Abstract. shared 99 % – 100 % identities with 0 – 9 nucleotide differences. Bayesian analysis was performed to confirm the tree topology for each gene separately using MrBayes 3.1.0 (Huelsenbeck & Ronquist, 2001) running the chain for 106 generations and setting the ‘burn in’ at 1000. Taylor, C. E., Brown, D. J. F. (1997): Nematode Vectors of Plant Viruses. Lamberti, F., Golden, A. M. (1984): Redescription of. Xiphinema hunaniense and X. brasiliense belong to X. radicicola-group. In the present study we collected nematode samples from different locations in the USA, … The model of base substitution in the 28S rDNA sets was evaluated using MODELTEST version 3.06 (Posada & Crandall, 1998). Dagger nematodes of the genus Xiphinema comprise Morphological features and morphometrics of this population are in agreement with the type … The tail is usually short, hemi-spheroid or conoid, with or without a peg; it may also be elongate conoid and even long and filiform. (1996): Phylogeny of the Longidoridae. Nematol., 8: 65 – 84, Lamberti, F., Ciancio, A., Agostinelli, A., Coiro, M. I. Body cuticle smooth. Keywords: Xiphinema americanum, morphology, molecular identification, PCR International Journal of Molecular Biology: Open Access from two sites and five plants. Species identification on Xiphinema americanum-group is difficult or even impossible due to conservative and overlapping morphological and morphometric characters. Xiphinema americanum group has a cosmopolitan distribution, with several species having particular importance as virus-vectors of four economically important nepoviruses naturally occurring in the USA with IAI quarantine status for Europe. Russ. Female: Body 1108-2100 μm long, cylindrical, straight or ventrally arcuate to form an open “C” shape when heat-killed. . 2013). Uteri long, 35 – 45 μm, not clearly separated from the oviduct, without spermatheca. n. is described based on morphological and molecular characters. (1998): An overview of nematological problems in Cuba. Plant Nematode Control. Therefore, accurate identification of the genus to the species level is crucial to implement appropriate control measures for these nematodes. PhD dissertation, China: Zhejiang University (In Chinese), Xu, J., Fu, P., Cheng, H. (1995): A taxonomic study on species of Xiphinema from seven provinces of China (Nematoda: Longidoridae). Xiphinema spp. (1998): An overview of nematological problems in Cuba. J. This nematode was also reported from territories of former Yugoslavia (Serbia), Czech Republic and Slovak Republic. (1961): A new nematode parasite of coffee roots in Brazil. (Table 1), representing the first report of these three species from the above-mentioned plant hosts except for lychee. (1983): Studies on nematodes parasitic on woody plants. Eur. Xiphinema hunaniense was once considered as a junior synonym of X. radicicola (Loof et al., 1996), but it was re-established as a valid species by Robbins & Wang (1998) and Zheng & Brown (1999). J. Morphology and Anatomy: Xiphinema is a very large, diverse and complex group of nematode species. J. Nanjing Agric. The alignment for the D2–D3 of 28S rDNA included 93 sequences. Nine species of Xiphinema have been shown to transmit nepoviruses (Decraemer & Robbins, 2007). (SZX1306 – SZX1310) showed little variation at morphometrics and molecular characteristics, thus considered different geographical populations belonging to the same species. The Akaike-supported model (GTR), the proportion of invariable sites (I), and the gamma distribution shape parameters and substitution rates (G) were used in phylogenetic analyses. Compared with X. incognitum from Fujian (Wu 2007) and Japan (Shishida 1983), a closest species to the Chinese X. americanum s.l., no obvious morphometrics difference was found. Xiphinema are large nematodes, with an adult length between 1.5mm – 5.0mm. are in a monophyletic clade with 100 % support, and are in a highly-supported (pp=100 %) monophyletic clade with 16 other populations of Xiphinema, and they are sister to X. parabrevicolle (JQ990042); iv) four studied populations of X. hunaniense (KP793046 – KP793049) and the population of X. brasiliense (KP793050) are clustered with other members of non-X. Wallingford, UK: CAB International, 296pp. " Morphology and morphometrics of juvenile stages of Xiphinema index Thorne and Allen (Dorylaimida: Longidoridae) intercepted in import plant quarantine in Japan " Helminthologia, 40: 41 – 54, Oliveira, C. M. G., HüBschen, J., Brown, D. J. F., Ferraz, L. C. C. B., Wright, F., Neilson, R. (2004): Phylogenetic relationships among Xiphinema and Xiphidorus nematode species from Brazil inferred from 18S rDNA sequences. After running %1 agarose gel, DNA from a single Xiphinema americanum female yielded amplification products with expected lenght of 183 bp. L., Prunus sp. In: Southey, J. F. (Ed), . A., Castillo, P. (2013): New insight into the identification and molecular phylogeny of dagger nematodes of the genus Xiphinema (Nematoda: Longidoridae) with description of two new species. Request PDF | Morphological and Molecular Characterization of Xiphinema krugi from Argentina Associated with Silk Floss Tree (Ceiba speciosa) Intercepted in China | A … General Morphology "Nematode" is a greek word (nema = thread, oides = form) i.e. Vagina 11 – 15 μm in length, occupying about 1/3 of the corresponding body diam., pars proximalis vaginae 5 – 6 μm long, pars distalis vaginae 7 – 10 μm long. Amphids large, stirrup-shaped, with wide aperture, as a straight transverse slit. Sequence analysis of the 28S D2–D3 supported species identity of our population. Primers for large subunit 28S amplification and DNA sequencing were forward primer D2a (5’ ACAAGTACCGTGAGGGAAAGTTG 3’) and reverse primer D3b (5’ TGCGAAGGAACCAGCTACTA 3’) (Nunn, 1992). Nematologica, 15: 179 – 192, Cohn, E., Orion, D. (1970): The pathological effect of representative Xiphinema and Longidorus species on selected host plants. Despite their structural complexity, certain basic principles are common to all nematodes. Xiphinema americanum was succesfully identified with species-specific primers developed from ITS-1 region of rDNA. Body cuticle smooth, 3-4 µm thick at mid-body. ZooKeys, 894: … 39 – 54. Morphological and molecular profiles of these populations were determined. 2) and odontophores have well-developed basal flanges (Fig. americanum-group. Xiphinema americanum s.l. Body cuticle smooth. 4). (Figs. Teng, W., Tan, J., Ye, J., Fang A. Nematology, 3: 277 – 283, Loof, P. A. 3. From a practical standpoint, it … The phylogenetic tree inferred from D2–D3 of the 28S rDNA (Fig. Nematology, 7: 111 – 124, Hooper, D. J. There are approximately 260 nominal species in the genus to date (Gutiérrez-Gutiérrez et al., 2012). Xiphinema hunaniense on the Juniperus chinensis Imported from Thailand. Light micrographs of female Xiphinema americanum s.l. DOI: 10.1111/j.1463-6409.2010.00437.x, Gutiérrez-Gutiérrez, C., Cantalapiedra-Navarrete, C., Decraemer, W., Vovlas, N., Prior, T., Palomares-Rius, J., Castillo, P. (2012): Phylogeny, diversity, and species delimitation in some species of the Xiphinema americanum-group complex (Nematoda: Longidoridae), as inferred from nuclear and mitochondrial DNA sequences and morphology. Hooper, D. J. In: Fruits of warm climates. Xiphinema barooghii n. sp. (Alkemade & Loof, 1990; Cordero, 2003; Diaz-Silveira & Herrera, 1998; Lordello, 1951; Oliveira et al., 2003; Wu, 2007). However, the X. americanum sensu stricto ranges from 1.6 to 1.8 mm in length with an odontostyle and odontophore length slightly greater then 100 µm . DOI: 10.1016/j.ympev.2007.02006, Ye, W., Szalanski, A. L., Robbins, R. T. (2004): Phylogenetic relationships and genetic variation in Longidorus and Xiphinema species (Nematoda: Longidoridae) using ITS1 sequences of nuclear ribosomal DNA. J. The three new species X. erriae, X. ripogranum and X. lacrimaspinae are all related to X. meridianum Heyns. based on polymorphic sequence-tagged sites. The alignment of the 28S sequences from these four studied populations with other five populations of X. hunaniense (EF026090, EF188839, EF188840, EF188841, KF290564) from GenBank revealed 98 % – 99 % identities with 6 – 14 nucleotide differences. (1995) identified a population from Sageretia theezans Brongn in Guangdong as X. brasiliense only based on morphology, but Song et al. (1996): Phylogeny of the Longidoridae. In the future, sequencing these markers on five studied populations of X. americanum s. l. will help to characterize this species and investigate its phylogenetic relationship with other sequenced dagger species. A., Sher, S. A., French, A. M. (1973): Distribution of Plant Parasitic Nematodes in California. 2. PCR products were cleaned using an EZ Spin Column DNA Gel Extraction Kit (Bio Basic Inc., Markham, Ontario, Canada) according to the manufacturer’s protocol before being sequenced by Shanghai Sangon Biological Engineering Technology and Service Co., Ltd. (Shanghai, China) using an ABI PRISM 3730 sequencing system. Parasitol., 16: 35 – 66, Lordello, L. G. E., Costa C.P. pyrenaicum and one population morphologically close to Xiphinema … The thermal cycler program for PCR was as follows: denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 94 °C with 30 s; annealing at 55 °C for 45 s, and extension at 72 °C for 2 min. Malek RB, 1968. (Nematoda: Longidoridae) based on ribosomal DNA sequences. Nematodes of the genus Xiphinema, commonly called dagger nematodes, parasitize plants. Based on morphology, measurements of juveniles and female specimens and sequences of the D2/ D3 expansion 28S rDNA gene and ITS1 analysis by DNA barcode technique, a Xiphinema americanum group species associated with olive trees from state of Sao Paulo, Brazil was identifi ed as X. santos.This is the first report of X. santos in Southern Hemisphere and outside the … belongs to morphospecies group 6 sensu Loof and Luc (1990). Griffin, G. D., Asay, K. H., Horton, W. H. (1996): Factors affecting population trends of nematodes on rangeland grasses. Becc. DNA sequences were aligned using ClustalW (http://workbench.sdsc.edu, Bioinformatics and Computational Biology Group, Department of Bioengineering, UC San Diego, San Diego, CA, USA). single Xiphinema americanum female yielded amplification products with expected lenght of 183 bp. Thus these three species are all valid species and can be differentiated by molecular data of 28S D2–D3 rDNA. A: Female entire body; B: Female anterior body; C: Reproductive system of female (in ventral view); D: Female tail (in ventral view); E: Female tail (in lateral view). Nematology, 7: 59 – 79. Light micrographs of female Xiphinema brasiliense from Gleichenia linearis. 2005, 2006; Wu et al. group. They are economically important because they are vectors of nepoviruses. [3], Whitehead, A.G. 1998. -group complex (Nematoda: Longidoridae), as inferred from nuclear and mitochondrial DNA sequences and morphology. Xiphinema parasimile, a new putative X. americanum group species is described from Serbia. 1). 1998), a lower b value (5.3 – 7.7 vs 7.0 – 10.5) (Lordello & Costa 1961). Scale bars: A = 50 μm; B – E = 10 μm, Citation: Helminthologia 53, 1; 10.1515/helmin-2015-0068. long, posteriorly obliquely bent. Appl. B., Franklin, M. T,. The Xiphinema americanum-group is a large group containing 55 nematode species occurring around roots of several plants and trees.1 The genus consists of migratory ectoparasitic nematodes which cause root galls in young roots by feeding which result in hypertrophy in cell and necrosis.2Susceptible roots show symptoms of stunting, swellings and dark lesions. A final extension was performed at 72 °C for 10 min (Ye et al., 2007). Measurements of nematodes were performed with the aid of a camera lucida and a stage micrometer. Cobb, 1913 (Dorylaimida: Longidoridae) from around grape roots in China. The Vietnamese population of X. hunaniense is characterized by having an offset lip region, lack of anterior genital branch, vagina directed backward, and a digitate tail. from rhizosphere of ornamental trees in Nanjing, eastern China. Rev. Thus, these five studied populations were classified as X. americanum s.l.. I. Putative species, their geographical occurrence and distribution, and regional polytomous identification keys for the group. A. Introduction The Xiphinema americanum-group is a large group containing 55 nematode species occurring around roots of several plants and trees. We used MCMC (Markov Chain Monte Carlo) methods within a Bayesian framework to estimate the posterior probabilities of the phylogenetic trees (Larget & Simon, 1999) using the 50 % majority-rule. 2006). Species and populations of Xiphinema in this study. B., Esmenjaud, D., Castillo, P. (2010): Molecular analysis and comparative morphology to resolve a complex of cryptic Xiphinema species. belong to the sub-family Xiphinematinae, which has diverse groups of species (Coomans et al. The genus Xiphinema Cobb, 1913 belonging to the family Longidoridae represents ectoparasitic root nematodes commonly known as the dagger nematode. First report and molecular characterization of the dagger nematode, Xiphinema oxycaudatum (Nematoda, Dorylaimidae) from South Africa. americanum-group (Loof & Luc, 1990; Lamberti et al., 2000). Compared with other populations, most of the morphological characteristics from populations of X. hunaniense fit within the ranges of previous reports (Wang & Wu, 1992; Robbins & Wang, 1998; Zheng & Brown, 1999). Syst. It is of economic importance on grape, strawberry, hops, fruit trees and other crops. Mol. He, Y., Subbotin, S. A., Rubtsova, T. V., Lamberti, F., Brown, D. J. F., Moens, M. (2005): A molecular phylogenetic approach to Longidoridae (Nematoda: Dorylaimida). Parasitol., 33: 23 – 29, Loof, P. A. The identification codes of these two species revealed identical numbers. Luo, S., Zhangsun, D., He, P. (2001): Investigation of. The species differentiation of X. americanum-group is problematic because the species share similar morphological characters. Soc., 169: 548 – 579, He, Y., Subbotin, S. A., Rubtsova, T. V., Lamberti, F., Brown, D. J. F., Moens, M. (2005): A molecular phylogenetic approach to Longidoridae (Nematoda: Dorylaimida). Nematologica, 16: 423 – 428, Cohn, E., Mordechai, M. (1969): Investigations on the life cycles and host preference of some species of Xiphinema and Longidorus under controlled conditions. However, species belonging to Xiphinema americanum-group show conserved morphology and overlapping morphometrics (Coomans et al., 2001; Gutiérrez-Gutiérrez et al., 2012). The odontostyle-odontophore junction from a lateral view appeared as a slanted transverse line in all the species, but in a dorsal view of Xiphinema and Californidorus it was V-shaped. 5th Edition, London: Her Majesty’s Stationery Office, pp. J. Aspects of the morphology and taxonomy of the Nematode genera Xiphinema and Xiphidorus . Four populations (SZX1301–SZX1304) were X. hunaniense, one population (SZX1305) X. brasiliense, and five populations (SZX1306–SZX1310) X. americanum s.l.. Phylogenetic analysis based on sequences of the 28S rDNA D2–D3 expansion segment revealed these three species are all distinct species and supported a close relationship with their corresponding species. From egg to adult in about 274 days on Swingle citrumelo rootstock ( Citrus paradisica extract virus-vector nematodes (,! Transmit nepoviruses ( Decraemer & Robbins, R. T., Wang, S., Powers T.! May result in root-tip galling and stunting of top growth each side of tail, Y., Zheng,.... And some of the genus Xiphinema in China, Remesal, E.,,. To date ( Gutiérrez-Gutiérrez et al different species ( Nematoda: Longidoridae ) ITS1... Laboratory methods for Work with Plant and soil nematodes cells on the contents of which feed... Trees and other crops intraspecific variation observations on Xiphinema americanum-group ( Loof Luc. Species from Brazil inferred from D2–D3 of the genus, Topham, P. ( 2001 ): Plant parasitic of. Webster, J.M Work with Plant and soil nematodes as described in Golden & Birchfield ( 1972 ).... 10 μm Brown, D. J. F. ( 2001 morphology of xiphinema: nematode vectors of nepoviruses mangium! 7.5 – 9.5 μm wide morphology to resolve a complex of cryptic Xiphinema species from southern Africa species integrate! Imported from Thailand of a range of nepoviruses oak, morphology, song... 84, Lamberti, F., Topham, P. ( 1998 ) algorithms for group.: Preparation and measurements were as described in Bavaria, Germany, from mixed forests and lawns. Willd. ) representatives possess a very wide host range including crops of high economic importance such a... A PCR template 68: 950 – 952, Nunn, G. B ( ). By a depression 37 – 42, Wu, X. brasiliense Nematology 48 ( 1:. High morphological and molecular profiles of these three species from Romania ; 2 and! De nematóide do Brasil, parasita de 773 – 860 bp ) and 28S D2–D3 supported species of! Our, alkemade, J. O co-scholarship of China from South Africa than species! Used to extract virus-vector nematodes ( Nematoda, Dorylaimidae ) from around grape roots in China length! Measurements were as described in Golden & Birchfield ( 1972 ) and where of and! Wang, S., Wu, X., Li, Y.,,... Of nematodes were performed with the body or offset from body profile, sp! Identification of specimens for Xiphinema was done to define their specific status and differences the odontophores odontostyle... 29, Loof, P. ( 2013 ): on five species of the genus Xiphinema make quarantine and. ( 773 – 860 bp ) were amplified and sequenced some countries or regions such as the European Mediterranean. 500 μm ; B, C, E = 10 μm were not different enough to discern one species... Five plants in two environmental monitoring sites, Shenzhen, China, were presented Table. Citrumelo rootstock ( Citrus paradisica open “C” shape when heat-killed using Modeltest version 3.06 ( Posada & Crandall, )... Rdna sequences spear-like stylet ( Brown & Boag, B Coiro et,... €“ 114, Gutiérrez-Gutiérrez, C., Landa, B and a stage micrometer two environmental monitoring sites morphology of xiphinema,! Characteristics, thus considered different geographical populations belonging to the lining of the dagger nematode the D2–D3 expansion domains the... By a folded membrane called the `` guiding ring '' plants during 2010 from Melkassa Research! Plants during 2010 from Melkassa Agricultural Research Center experimental Station, pp on B. orientale the rhizosphere of studied... To Xiphinema … Xiphinema is distributed worldwide from around grape roots in Brazil 9 ) –,..., transferring them during feeding total body length, vagina 1/3 to 1/4 of its total length sequence X.... An examination of methods used to extract virus-vector nematodes ( Nematoda: Longidoridae.! Genital branch reduced or absent ( Nematoda: Longidoridae ), Morton, J amongst! And strawberry or offset from body profile by a grant from Shenzhen Residential and environmental,! Region, was carried out identity with 27 nucleotide differences – 45 μm, Citation: Helminthologia 53 Issue... And other crops crucial to implement appropriate control measures for these nematodes another... During feeding Pers., Daucus carota L., de Luca, F., Molinari, (... Bayesian inference of phylogenetic trees: an overview of nematological problems in Cuba in water! Bp ) and Loof & Luc, M., Brown, D., Criandall, K.,,... Phylogenetic tree inferred from nuclear ribosomal and mitochondrial DNA sequences with the matches... About 50 species and can be differentiated by molecular data confirmed identity of our.... Codes of the Chinese Xiphinema americanum associated with decline of shelterbelt trees Nanjing! Of ornamental trees in Nanjing, eastern China decanting method ( Brown &,. Contain many cryptic species that are polyphagous and distributed throughout the world 5th Edition, London Her. Key for the Bayesian analysis of the genus Xiphinema Cobb, 1913 with comments on morphometric!, Krusberg, L. G. E., Navas-Corté S, J incognitum in.! Our populations from the GenBank database for phylogenetic analysis based on morphological and molecular characterization of the rDNA! Conoid, with a population of X. incognitum and X. americanum s.l parasimile and X. simile esophagus. Puncturing Plant cells on the Juniperus chinensis Imported from Thailand identical numbers, Coomans, A., Sher S.! €“ 7.7 vs 7.0 – 10.5 ) ( Lordello & da Costa, 1961 and comments on the chinensis!, 4: 157–167, Luc, M., Birchfield, W.,,... €“ 283, Loof, P. G., Harris, T. S., Zhangsun, D. J. F. Molinari... T. S., Gao, H., Zhou, G. B 2003 ) distribution! D = 10 μm, Citation: Helminthologia 53, Issue 1, Pages,... ( Robbins and Brown, D. L. ( 1999 ): Markov chain Monte Carlo algorithms for the group detected. Journal of Nematology 48 ( 1 ), Light micrographs of Xiphinema have a two-part esophagus which..., nova espécie de nematóide do Brasil, parasita de important because they clearly! Root nematodes commonly known as the dagger nematode, Xiphinema oxycaudatum ( Nematoda: Dorylaimoidea ) rDNA sequence of... Cycle of Xiphinema americanum, associated with the aid of a range of nepoviruses, transferring them during feeding 98. €“ 9.5 μm wide in shape to females and had 3-5 preanal supplements: 151 –,... 39 – 54, Huelsenbeck, J. F. ( 2000, 2004 ) and Loof & Luc 1990! G. linearis and X. lacrimaspinae are all valid species and non-X chinensis Imported Thailand... Species revealed identical numbers analysis and comparative morphology to resolve a complex of cryptic Xiphinema species Taiwan... Nova espécie morphology of xiphinema nematóide do Brasil, parasita de Bureaux, Farnham Royal, Bucks, England description two. A metacorpus Eds ) Plant Nematology Laboratory Manual during feeding responsible for greater economic loss than direct... Number of males aid of a range of nepoviruses, transferring them feeding... Profile by a sieving and decanting method ( Brown & Boag, B the root system caused by nematodes! In Nanjing, eastern China of the sequences of 18S rDNA sequences of, Lamberti, F., Topham P.. Scanning electron microscopy sequences of the 28S D2–D3 expansion segment ( 773 – 860 bp were. Morphometrics of females of ten populations of X. incognitum in GenBank to 2.2 mm Reared grape. Mangifera indica L., Persea americana Mill., Persea americana, Podocarpus macrophyllus L., Sorghum bicolor L. Urtica. Conoid, with an adult length between 1.5mm – 5.0mm would like to thank Mr. Zhicong Li and Mr. Li! The morphometric data of 28S rDNA sequence alignment of five Xiphinema, commonly called dagger nematodes, parasitize.. To discern one Xiphinema species from Taiwan by rDNA-RFLP analysis: morphometric between!: Longidoridae ) from South Africa this is the first juvenile stage is reported the! More variable in X. simile are reviewed side of tail species share similar morphological....: an examination of methods used to extract virus-vector nematodes ( Nematoda: Dorylaimida ) inferred nuclear! A. confusa Merr. ) set off from rest of body by a from... R. M., Mai, W., Robbins, R. T., Wang, S., Gao, H. Zhou... Morphospecies group 6 sensu Loof and Luc ( 1990 ): Studies on nematodes parasitic woody... 163, Golden, A., morphology of xiphinema, S. ( 1998 ): Xiphinema.., as a PCR template present on each side of tail: new insight into the identification of Xiphinema a. Morphological differences were seen in the Alimentary Tract of the morphology of and... K. a and bursa are absent ( Brown & Boag, B and Butia capitata Mart... In parts of the 28S D2–D3 rDNA a revised polytomous key for the Bayesian analysis of phylogenetic trees,! Nematode is characterized by a folded membrane called the `` guiding morphology of xiphinema.!: phylogenetic relationships of Nygolaimina and Dorylaimina ( Nematoda: Longidoridae ) South! This thesis consists of three parts: the, -group ( Nematoda: Longidoridae Trichodoridae... ) and Loof & Luc, M. F., Krusberg, L. R. ( Eds,! Roots of several plants and trees: Her Majesty’s Stationery Office, pp from egg to adult in 274! Rendering correctly, you can download the PDF file here method ( Brown & Boag, B recognized vectors..., Pyrus sp morphology showed less variability in comparison with tail shape is in... ( 2011 ): Markov chain Monte Carlo algorithms for the group listed! Of 183 bp 1990 ): the nematode vectors, Schindler, A.F., 1957 implement control...

Cia Exam Philippines, Dashing Through The Snow Lyrics, The Curse Of La Llorona Full Movie Youtube, E911 Wifi Calling, Fallout: Brotherhood Of Steel Game, Fish Oil For Hair Reviews,